The short version of lyophilized powder fits in a sentence. The long version — which is the one that helps — is below.
Reviewed 2026-01-20. Anything still debated is marked as such rather than presented as settled.
Melanotan II is a synthetic peptide analog modeled on alpha-melanocyte-stimulating hormone, a naturally occurring signaling peptide involved in pigmentation. Its structure is a cyclic heptapeptide containing two non-natural substitutions, norleucine at position four and D-phenylalanine at position seven. These modifications resist enzymatic breakdown and extend the molecule's activity relative to the native hormone. The compound binds melanocortin receptors and is studied mainly as a pharmacological tool rather than a therapeutic product. It has never received approval as a medicine in any major jurisdiction.
The compound was developed in the late 1980s and 1990s by academic researchers investigating photoprotection. The rationale held that stimulating melanin production might reduce ultraviolet damage to skin and lower skin cancer risk. Early work examined receptor binding, pigment response, and short-term tolerability in small studies. That program did not produce an approved drug, and formal development stalled after early-phase trials. Whether induced pigmentation confers meaningful photoprotection remains an open question.
Outside regulated medicine, melanotan II circulates through online vendors as a research chemical, often marketed for tanning. Products sold this way vary widely in purity, concentration, and labeling accuracy, and independent testing has documented discrepancies. Published reports describe both pigment effects and adverse reactions, including nausea, flushing, and darkening of existing moles. Long-term safety data are sparse, and no large controlled trial has established a risk profile. Questions about cumulative effects on melanocytes remain unresolved in the literature.
The material is commonly handled as a lyophilized powder in sealed vials. The solid dissolves readily in water and in polar organic solvents, producing a clear solution after reconstitution. Light, heat and repeated freeze-thaw cycles are the concerns most often raised in handling guidance, because peptide bonds and the constrained ring can degrade. Working solutions are generally prepared fresh, and material left in solution is treated as less stable than the dry form. These properties shape how laboratories store and aliquot reference material.
Identity and purity are assessed mainly by reversed-phase high-performance liquid chromatography with ultraviolet detection, often paired with mass spectrometry. Retention time supports identity, while the mass spectrum confirms the molecular weight of the intact peptide. Purity is frequently reported as a percentage of total peak area, a figure that depends on the wavelength, column and gradient used. Impurity profiling may also look for truncated sequences, oxidised forms and residual counterions. Amino acid analysis and peptide mapping provide orthogonal confirmation when required.
Regulatory status varies by jurisdiction, and the substance is frequently described as unapproved for therapeutic use. Some authorities classify it alongside prescription-only medicines or controlled categories, while others address it through general consumer protection rules. Analytical surveys have reported mismatches between label claims and measured content in products sold online, although the scope of such testing is limited. Whether these discrepancies are widespread remains an open question. Discussion in the literature therefore tends to combine chemistry, supply-chain observation and policy analysis.
| Property | Value | Notes |
|---|---|---|
| Chemical class | Synthetic cyclic heptapeptide | Belongs to the melanocortin agonist family |
| Key substitutions | Nle4 and D-Phe7 | Improve resistance to enzymatic degradation |
| Molecular formula | C50H69N15O9 | Approximately 1024 g/mol |
| Regulatory status | Not approved as a medicine | Distributed as a research chemical |
| Common synonyms | Melanotan II, MT-II, MT-2 | Spelling varies across sources |
Melanotan II is a synthetic cyclic heptapeptide analog derived from the core sequence of alpha-melanocyte-stimulating hormone. Researchers at the University of Arizona synthesized it during the 1980s while studying pigmentation and appetite signaling. The compound is not an approved medicine in any major jurisdiction and appears mainly in laboratory and research-chemical settings. Its structure incorporates a lactam bridge between side chains, which constrains the ring and slows enzymatic breakdown relative to the natural hormone.
Melanotan II binds several melanocortin receptor subtypes rather than a single target. MC1R on melanocytes drives melanin synthesis, while MC3R and MC4R participate in energy balance, appetite, and sexual response pathways. This lack of selectivity explains why reported effects extend beyond skin darkening. Substitutions at positions four and seven, including norleucine and D-phenylalanine, increase potency and resistance to peptidases. Understanding which receptor mediates which effect remains an active area of investigation.
Melanotan II holds no marketing authorisation from the Food and Drug Administration, the European Medicines Agency, the UK Medicines and Healthcare products Regulatory Agency or Australia's Therapeutic Goods Administration. Products sold under that name are treated as unapproved new drugs, and their sale or import is prohibited in several jurisdictions. Other countries classify the peptide as a prescription-only medicine or place it among controlled substances, so the legal position changes with the destination market. No pharmacopoeial monograph supplies an official specification, because the material is not a licensed pharmaceutical. Consequently, products offered online are not manufactured to a shared public standard.
The peer-reviewed record is dominated by small early-phase studies, case reports and pharmacovigilance summaries rather than large randomised trials. Papers typically examine tanning response, receptor selectivity or patterns of reported adverse events. Many note that participants obtained the peptide outside a clinical setting, which limits verification of composition and administered amount. Reported events vary widely, and causality is frequently unclear because the identity and purity of self-sourced material are unknown. Open questions include whether repeated melanocortin receptor stimulation produces cumulative effects, and how often label claims match actual content.
=== Pharmacodynamics === Nicotinic acid activates the HCA2 receptor, which has effects in addition to lowering serum cholesterol and triglyceride concentrations: antioxidative, anti-inflammatory, antithrombotic, improved endothelial function and plaque stability, all of which counter development and progression of atherosclerosis. Nicotinic acid inhibits cytochrome P450 enzymes CYP2E1, CYP2D6 and CYP3A4. Niacin produces a rise in serum unconjugated bilirubin in normal individuals and in those with Gilbert's Syndrome. However, in the Gilbert's Syndrome, the rise in bilirubin is higher and clearance is delayed longer than in normal people. One test used to aid in diagnosing Gilbert's Syndrome involves intravenous administration of nicotinic acid (niacin) in a dose of 50 mg over a period of 30 seconds.
== Classification == There are over 100 peptides which have been claimed as falling within this group, though most of them have relatively little published research and only a dozen or so such compounds are widely known and well characterised. Most compounds referred to as matrikines are synthetic versions of peptide fragments 2-6 amino acids in length which are found in connective tissue proteins such as collagen, elastin, fibronectin and laminin, and were originally isolated as products of the enzymatic hydrolysis of these proteins. Many of these form naturally in the body following injury or tissue damage, and act as signalling factors which trigger tissue repair processes. Larger protein fragments cleaved from the full length connective tissue proteins, such as arresten, canstatin and tumstatin, also have similar functions and may be grouped along with the smaller peptide matrikines. There are also other peptide fragments which are commonly included in the matrikine group on the basis of their similar activity, despite not being derived from connective tissue proteins.
α-D-mannopyranoside was the most effective for desorbing Con A from pAPM at virtually 100% after 1 hour. As a control, pAPM was used to bind Con A from a crude extract, which found the pickup of several impurities but still managed to recover 80% of Con A. This exemplifies the need for selective moieties, maltose not residing among them. Finally, the application of pAPM was tested by attempting to separate α-glucosidase from yeast extract under low temperature conditions. In conclusion, the pAPM was found to recover 68% of α-glucosidase activity tested against, maltose being the selected desorption reagent. Another interesting development for AC was involved with antibody separation using another TRP-ligand combination. Anastase-Ravion et al. attached a dextran derivative to the classic PNIPAAm to result in a poly(NIPAAm)-DD, and used this stationary phase to separate polyclonal antibodies from subcutaneous rabbit serum. From the study, the dextran derivative of choice was carboxymethyl dextran benzylamide sulfonate/sulfate, and when bound to the TRP was labeled poly(NIPAAm)-CMDBS. The LCST for the poly(NIPAAm)-CMDBS was raised from 32 °C to 33 °C. To test the success of the affinity binding, the antibodies were eluted with glycine buffer (adjusted to pH 2.6 with HCl). Promising results were obtained in 2003 in a study that merged the newer developments in affinity chromatography with microfluidic devices.
Sources: en.wikipedia.org
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488), 30-mer, 20% G, 43% CG, Predicted Tm: 88.9 °C at 10 μM oligo. Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
=== Early career === In 1966, Jim and Tammy Faye Bakker began working at Pat Robertson's Christian Broadcasting Network (CBN) in Portsmouth, Virginia, which had an audience in the low thousands at the time. The Bakkers contributed to the network's growth, hosting a children's variety show called Come On Over that employed comic routines with puppets. Due to the success of Come On Over, Robertson made Bakker the host of a new prime-time talk show, The 700 Club, which gradually became CBN's flagship program. The Bakkers left CBN in 1973 and, soon after, joined with Paul and Jan Crouch to help co-found the Trinity Broadcasting Network (TBN) in California. However, this partnership lasted only eight months until a falling-out between Jim Bakker and Paul Crouch caused the Bakkers to eventually leave the new network.
Cold fission Fissile material Fission fragment reactor Hybrid fusion/fission Nuclear fusion Nuclear propulsion Photofission HD 101065 – Star in the constellation Centaurus which contain large amount of thorium, uranium and some short-lived radioactive isotopes.
Sources: en.wikipedia.org
Antidotes are agents that can neutralise the effects of a poison or toxin. Antidotes counteract the effects of toxins in many ways, such as by blocking the absorption of the toxin, binding and neutralising the poison, opposing the toxin's end-organ function, or blocking the toxin's conversion to more hazardous metabolites. In addition to lowering the amount of free or active poison present, antidote delivery may also lessen the toxin's effects on organs through competitive inhibition, receptor blockage, or direct antagonistic interaction. The therapeutic index or ratio (TD50/ED50), which is the ratio of the toxic dosage (TD) or fatal dose (LD) to the effective dose (ED), determines the level of safety associated with a substance.
7-Fluorotryptamine (7-FT) is a serotonin receptor modulator and weak GPRC5A agonist of the tryptamine family. It is the 7-fluoro derivative of tryptamine. The drug is a low-potency agonist of the orphan receptor GPRC5A, with an EC50Tooltip half-maximal effective concentration of 7,200 nM. In addition to its GPRC5A agonism, 7-fluorotryptamine interacts with other receptors, such as the serotonin 5-HT4 receptor. Derivatives of 7-fluorotryptamine have been described. 7-Fluorotryptamine was first described in the scientific literature by 1979. Its GPRC5A agonism was first described in 2023. Substituted tryptamine 7-Chlorotryptamine 7-Methyltryptamine 7-Hydroxytryptamine 7-F-5-MeO-MET 7-Chloro-AMT 7-Fluorotryptamine - Isomer Design
Some mycoviruses also contain toxin genes expressed by host fungal species upon viral infection. While these toxins are classified as mycotoxins, the role of mycoviruses is also of interest to researchers in terms of fungal virulence. Examples include the mycoviruses ScV-M1, ScV-M2, and ScV-M28 in the Totiviridae family that contain "killer toxin" genes K1, K2, and K3, respectively. These "killer toxins" are produced by yeast, namely of the Saccharomyces cerevisiae species, that destroy neighboring yeast cells. Recently, researchers discovered that it is only the yeasts infected with either ScV-M1, ScV-M2, or ScV-M28 mycoviruses that have the ability to produce a "killer toxin".
Sources: en.wikipedia.org
It is a synthetic cyclic peptide designed as an analog of alpha-melanocyte-stimulating hormone. It acts on melanocortin receptors and is best known from research into pigmentation. It is not an approved pharmaceutical product.
No regulatory agency has approved it for any indication. It is encountered as a research chemical sold outside pharmaceutical supply chains. Products marketed this way are not subject to the manufacturing and labeling requirements that apply to approved drugs.
Reports describe increased skin pigmentation as well as side effects such as nausea, flushing, and changes to existing moles. Much of the evidence comes from small studies and case reports rather than large trials. The long-term safety profile is therefore uncertain.
The dry powder is more stable during transport and storage than a solution. It also allows a known amount of material to be reconstituted at a chosen concentration.